Przemijające wysokie poziomy wiremii u pacjentów z pierwotnym ludzkim niedoborem odporności typu 1 Zakażenie cd

Podczas swojej pierwszej prezentacji miał całkowitą liczbę limfocytów CD4 wynoszącą 0,97 × 109 na litr, przy współczynniku limfocytów pomocniczych / supresorowych wynoszącym 2,0. Jego choroba ustąpiła całkowicie w ciągu następnych dwóch tygodni i pozostał bezobjawowy. Metody
Sekwencyjne próbki osocza od wszystkich czterech pacjentów testowano na antygen p24 z komercyjnym testem immunoenzymatycznym (Abbott Laboratories, North Chicago). Przeciwciała swoiste dla HIV-1 w osoczu od każdego pacjenta zmierzono za pomocą komercyjnego testu immunoenzymatycznego i testu Western blot (Genetic Systems, Seattle). Stwierdzono, że porcja (0,2 ml) wolnego od komórek płynu mózgowo-rdzeniowego od Pacjenta była dodatnia pod względem HIV-1 w hodowli za pomocą metody opisanej gdzie indziej.11 Ocenę ilościową zakaźnego HIV-1 w świeżo otrzymanym osoczu i PBMC wykonał metody hodowli w punkcie końcowym rozcieńczenia, jak opisano poprzednio.9 Miana zakaźnego wirusa w osoczu wyrażano jako dawki infekcyjne dla hodowli tkankowej (TCID) na mililitr, a miana w PBMC wyrażano jako TCID na 106 komórek.
Oznaczenie liczby kopii DNA HIV-1 w PBMC przeprowadzono za pomocą ilościowej metody PCR Panga i wsp. [10] Krótko, 1,0 .g DNA z każdej próbki poddano 25 cyklom PCR, z znakowanymi 32Pend starterami oligonukleotydowymi (M661- CCTGCGTCGAGAGACTCCTCTGG i M667-GGCTAACTAGGGAACCCACTG) z regionu LTR / gag. Zamplifikowany produkt poddano następnie elektroforezie na 8% żelu akryloamidowym i analizowano za pomocą autoradiografii.
Wyniki
Ryc. 1. Ryc. 1. Sekwencyjne zmiany miana przeciwciał HIV-1 (kręgów stałych) i stężeń antygenu p24 (otwarte kółka) w osoczu badanych czterech pacjentów oraz w ich tytułach infekcyjnego HIV-1 w osoczu (otwarte trójkąty) i PBMC (stałe trójkąty). Flu oznacza zespół podobny do mononukleozy i zespół GB Guillain-Barré. Strzałki wskazują przebieg plazmaferezy u Pacjenta 1.
Serokonwersję do HIV-1 udokumentowano za pomocą testu immunoenzymatycznego u wszystkich czterech pacjentów na podstawie rozwoju i późniejszego wzrostu specyficznych przeciwciał w osoczu (Fig. 1). Specyfika odpowiedzi humoralnej poszerzyła się również w czasie, jak wykazano w analizie Western, z przeciwciałami rozpoznającymi stopniowo więcej białek HIV-1 podczas serokonwersji (dane nie przedstawione). Kinetyka rozwoju odpowiedzi swoistej dla HIV-1 była czasowo podobna u wszystkich czterech pacjentów, w tym u pacjenta 1, u którego wystąpiła powtórna plazmafereza.
Gdy po raz pierwszy zaobserwowano czterech pacjentów, antygen p24 był łatwo wykrywalny w osoczu każdego z bardzo wysokich poziomów szczytowych w zakresie od 1200 do 4200 pg na mililitr (ryc. 1). Jednak u pacjentów 1, 2 i 4 stężenie antygenu p24 zmniejszało się gwałtownie do poziomu niewykrywalnego w ciągu 7 do 12 dni. W przypadku pacjenta 3 (ryc. 1) nie można było dokładnie ocenić szybkości spadku stężenia antygenu p24 w osoczu, ponieważ nie uzyskano próbek krwi pomiędzy dniami 15 i 48.
Szczytowe miana zakaźnego HIV-1 w osoczu tych czterech pacjentów, którzy przeszli serokonwersję, jak określono w kulturze rozcieńczeń w punkcie końcowym, wynosiły od 1000 do 10 000 TCID na mililitr (ryc. 1) – poziomy zakaźnego HIV-1, które wcześniej stwierdzono tylko u pacjentów z zespołem nabytego niedoboru odporności (AIDS) lub zespołem związanym z AIDS.9 Następnie miana HIV-1 w osoczu spadły do do 2 TCID na mililitr wszystkich pacjentów (ryc.
[przypisy: wyszukiwarka leków, ministerstwo zdrowia lista leków dla seniorów, implanty zeby ]